Stem-loop sequence bmo-mir-993a

AccessionMI0010626 (change log)
DescriptionBombyx mori miR-993a stem loop
Gene family MIPF0000033; mir-10
Stem-loop
   ggca  uu     uc    c      uc          uagauu 
5'     ca  cguga  uacc uguaga  cgggcuuuug      a
       ||  |||||  |||| ||||||  ||||||||||       
3'     gu  gcacu  augg acaucu  gcucgaagac      a
   -aag  cg     cu    -      cu          uacauu 
Get sequence
Deep sequencing
476 reads, 33.3 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
NW_004582018.1: 2433576-2433663 [+]
intergenic
Database links

Mature sequence bmo-miR-993a-5p

Accession MIMAT0015298
Previous IDsbmo-miR-993a*
Sequence

14 - 

ucuacccuguagauccgggcuuuu

 - 37

Get sequence
Deep sequencing449 reads, 3 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence bmo-miR-993a-3p

Accession MIMAT0010129
Previous IDsbmo-miR-993a
Sequence

55 - 

gaagcucgucucuacagguaucu

 - 77

Get sequence
Deep sequencing27 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
" Griffiths-Jones S Unpublished (2009).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).