Stem-loop sequence bmo-mir-993b

AccessionMI0010625
DescriptionBombyx mori miR-993b stem loop
Gene family MIPF0000033; mir-10
Stem-loop
   ---------------------------------   a  uu      c    c      uc          uaaaa 
5'                                  ggc ca  cgugau uacc uguaga  cgggcuuucg     a
                                    ||| ||  |||||| |||| ||||||  ||||||||||      
3'                                  ccg gu  gcacua augg acaucu  gcucgaaagc     a
   gucaagaacugauuaacaucuuuuccaccgcac   -  cg      u    -      cu          uaaac 
Get sequence
Deep sequencing
160 reads, 37.2 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
nscaf2734: 2625-2743 [-]
intergenic

Mature sequence bmo-miR-993b-5p

Accession MIMAT0015297
Previous IDsbmo-miR-993b*
Sequence

16 - 

uacccuguagauccgggcuuucg

 - 38

Get sequence
Deep sequencing146 reads, 3 experiments
Evidence experimental; Illumina [2]

Mature sequence bmo-miR-993b-3p

Accession MIMAT0010128
Previous IDsbmo-miR-993b
Sequence

53 - 

aaagcucgucucuacagguauau

 - 75

Get sequence
Deep sequencing8 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
" Griffiths-Jones S Unpublished (2009).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).