Stem-loop sequence bmo-mir-274

AccessionMI0010624 (change log)
DescriptionBombyx mori miR-274 stem loop
Gene family MIPF0000264; mir-274
Literature search

3 open access papers mention bmo-mir-274
(16 sentences)

Stem-loop
   ggcuguu         a   g    -    c     cu       - g   u 
5'        guuaggcga guu guuu guga cguca  aacgggc a ugu a
          ||||||||| ||| |||| |||| |||||  ||||||| | |||  
3'        caguucgcu caa uaaa cgcu gcggu  uugcucg u gca a
   -------         -   g    a    a     -u       u g   u 
Get sequence
Deep sequencing
14627 reads, 2.4e+03 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
NW_004581747.1: 1284148-1284242 [-]
intergenic
Database links

Mature sequence bmo-miR-274-5p

Accession MIMAT0010127
Previous IDsbmo-miR-274
Sequence

22 - 

guuugugaccgucacuaacgggcagu

 - 47

Get sequence
Deep sequencing14001 reads, 3 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence bmo-miR-274-3p

Accession MIMAT0015296
Previous IDsbmo-miR-274*
Sequence

62 - 

ucguuuuggcgaucgcaaaaug

 - 83

Get sequence
Deep sequencing615 reads, 3 experiments
Evidence experimental; Illumina [2]
Database links

References

1
" Griffiths-Jones S Unpublished (2009).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).