Stem-loop sequence bmo-mir-965

AccessionMI0010623 (change log)
DescriptionBombyx mori miR-965 stem loop
Gene family MIPF0000708; mir-965
Stem-loop
   auauaaaug  -           ac             g    a    ucaau 
5'          gc ugcauagcuaa  gggagaagcuaua cgcu uaug     a
            || |||||||||||  ||||||||||||| |||| ||||     u
3'          cg acguauugguu  cccuuuucgauau gcga auac     u
   -cucuuaua  u           -c             -    -    uaaaa 
Get sequence
Deep sequencing
3838 reads, 533 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
NW_004582012.1: 8411478-8411581 [-]
intergenic
Database links

Mature sequence bmo-miR-965-5p

Accession MIMAT0015295
Previous IDsbmo-miR-965
Sequence

24 - 

cgggagaagcuauagcgcuauaug

 - 47

Get sequence
Deep sequencing2785 reads, 3 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence bmo-miR-965-3p

Accession MIMAT0010126
Previous IDsbmo-miR-965;bmo-miR-965*
Sequence

63 - 

uaagcguauagcuuuuccccuu

 - 84

Get sequence
Deep sequencing1052 reads, 3 experiments
Evidence experimental; Illumina [2]
Database links

References

1
" Griffiths-Jones S Unpublished (2009).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).