Stem-loop sequence bmo-mir-970

AccessionMI0010622
DescriptionBombyx mori miR-970 stem loop
Gene family MIPF0000700; mir-970
Stem-loop
   ---     gaa           uu       c      u     u  gac 
5'    uggag   uagacagagcc  gcgugug ucuuau gguag gu   u
      |||||   |||||||||||  ||||||| |||||| ||||| ||    
3'    accuc   gucugucucgg  cgcacac agaaua cuauc ua   g
   gcg     --a           --       -      -     -  aua 
Get sequence
Deep sequencing
701 reads, 266 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
nscaf3026: 2364808-2364899 [+]
intergenic

Mature sequence bmo-miR-970-5p

Accession MIMAT0015294
Previous IDsbmo-miR-970*
Sequence

16 - 

agccuugcgugugcucuuauuggua

 - 40

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [2]

Mature sequence bmo-miR-970-3p

Accession MIMAT0010125
Previous IDsbmo-miR-970
Sequence

58 - 

ucauaagacacacgcggcucu

 - 78

Get sequence
Deep sequencing606 reads, 3 experiments
Evidence experimental; Illumina [2]

References

1
" Griffiths-Jones S Unpublished (2009).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).