Stem-loop sequence bmo-mir-252

AccessionMI0010621 (change log)
DescriptionBombyx mori miR-252 stem loop
Gene family MIPF0000285; mir-252
Literature search

5 open access papers mention bmo-mir-252
(9 sentences)

Stem-loop
   aacuaaa   ug  cc        -  u  c       c  uuu 
5'        ccu  uu  uaaguacu ag gc gcaggag gu   g
          |||  ||  |||||||| || || ||||||| ||    
3'        gga  aa  auucguga uc cg cguccuc ua   u
   --auuug   gu  cu        a  -  u       -  uga 
Get sequence
Deep sequencing
320 reads, 33.3 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
NW_004581747.1: 1258448-1258532 [-]
intergenic
Database links

Mature sequence bmo-miR-252-5p

Accession MIMAT0010124
Previous IDsbmo-miR-252
Sequence

16 - 

cuaaguacuagugccgcaggag

 - 37

Get sequence
Deep sequencing318 reads, 3 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence bmo-miR-252-3p

Accession MIMAT0015293
Previous IDsbmo-miR-252*
Sequence

53 - 

ccugcugccuaagugcuuauca

 - 74

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [2]

References

1
" Griffiths-Jones S Unpublished (2009).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).