Stem-loop sequence ame-mir-993

AccessionMI0010620 (change log)
DescriptionApis mellifera miR-993 stem loop
Gene family MIPF0000033; mir-10
Literature search

1 open access papers mention ame-mir-993
(1 sentences)

Stem-loop
   ggca         uc    c      uc          uagaau 
5'     cauucguga  uacc uguaga  cgggcuuuug      u
       |||||||||  |||| ||||||  ||||||||||      g
3'     guaggcauu  augg acaucu  gcucgaagac      u
   -aca         cu    -      cu          uauaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
CM000069.5: 2418122-2418210 [+]
intergenic
Database links

Mature sequence ame-miR-993-3p

Accession MIMAT0010123
Sequence

56 - 

gaagcucgucucuacagguaucu

 - 78

Get sequence
Evidence experimental; Illumina [1-2]

References

1
" Griffiths-Jones S Unpublished (2009).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).
3
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).