Stem-loop sequence ame-mir-316

AccessionMI0010619 (change log)
DescriptionApis mellifera miR-316 stem loop
Gene family MIPF0000254; mir-316
Literature search

3 open access papers mention ame-mir-316
(4 sentences)

Stem-loop
   ---      cc      gu    u     g        cc  u  aa 
5'    gugugg  gagggu  gucu uuucc cuuugcug  gc ga  u
      ||||||  ||||||  |||| ||||| ||||||||  || ||  g
3'    cacgcc  cuccca  cgga aaggg gaaacgac  cg cu  g
   aac      --      gc    c     -        --  c  ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
CM000068.5: 3005291-3005379 [+]
intergenic
Database links

Mature sequence ame-miR-316-5p

Accession MIMAT0010122
Sequence

16 - 

ugucuuuuuccgcuuugcugccg

 - 38

Get sequence
Evidence experimental; Illumina [1-2]

References

1
" Griffiths-Jones S Unpublished (2009).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).
3
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).