Stem-loop sequence ame-mir-1006

AccessionMI0010617 (change log)
DescriptionApis mellifera miR-1006 stem loop
Literature search

1 open access papers mention ame-mir-1006
(1 sentences)

Stem-loop
   -au    ucu   aa         aaa     a 
5'    uggu   gaa  gaauugagu   uuuau u
      ||||   |||  |||||||||   ||||| u
3'    acua   cuu  uuuagcuua   aaaua a
   auu    --u   -c         ---     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
CM000056.5: 1971255-1971316 [+]
intergenic
Database links

Mature sequence ame-miR-1006-3p

Accession MIMAT0010120
Sequence

39 - 

aaaauucgauuucuucuaucauua

 - 62

Get sequence
Evidence experimental; Illumina [1-2]

References

1
" Griffiths-Jones S Unpublished (2009).
2
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).
3
PMID:26853694 "MicroRNA signatures characterizing caste-independent ovarian activity in queen and worker honeybees (Apis mellifera L.)" Macedo LM, Nunes FM, Freitas FC, Pires CV, Tanaka ED, Martins JR, Piulachs MD, Cristino AS, Pinheiro DG, Simoes ZL Insect Mol Biol. 25:216-226(2016).