Stem-loop sequence ame-mir-13b

AccessionMI0010609 (change log)
DescriptionApis mellifera miR-13b stem loop
Gene family MIPF0000049; mir-2
Literature search

1 open access papers mention ame-mir-13b
(1 sentences)

Stem-loop
   g        -        -u        gc   -uug  u 
5'  cgauccaa ucgucaaa  ugguugug  gug    cu u
    |||||||| ||||||||  ||||||||  |||    || u
3'  gcuagguu agcaguuu  accgacac  uac    ga c
   -        u        uu        ua   uuua  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
CM000054.5: 1246714-1246792 [+]
intergenic
Database links

Mature sequence ame-miR-13b-3p

Accession MIMAT0010114
Sequence

50 - 

uaucacagccauuuuugacgauu

 - 72

Get sequence
Evidence experimental; RTPCR [2], Illumina [3]

References

1
" Griffiths-Jones S Unpublished (2009).
2
3
PMID:22409512 "Behavioral plasticity in honey bees is associated with differences in brain microRNA transcriptome" Greenberg JK, Xia J, Zhou X, Thatcher SR, Gu X, Ament SA, Newman TC, Green PJ, Zhang W, Robinson GE, Ben-Shahar Y Genes Brain Behav. 11:660-670(2012).