Stem-loop sequence aga-mir-309

AccessionMI0010607 (change log)
DescriptionAnopheles gambiae miR-309 stem loop
Gene family MIPF0000140; mir-3
Literature search

3 open access papers mention aga-mir-309
(25 sentences)

Stem-loop
   aag            cc      ag    uccgauu 
5'    augcgacaaacu  guccag  ggug       u
      ||||||||||||  ||||||  ||||       c
3'    uacgcuguuuga  cggguc  cuac       a
   aaa            aa      -a    ucaagua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
chr3R: 43008711-43008784 [-]
intergenic
Database links

Mature sequence aga-miR-309

Accession MIMAT0010112
Sequence

49 - 

ucacugggcaaaguuugucgca

 - 70

Get sequence
Evidence by similarity; MI0000421

References

1
" Griffiths-Jones S Unpublished (2009).