Stem-loop sequence aga-mir-286

AccessionMI0010605 (change log)
DescriptionAnopheles gambiae miR-286 stem loop
Gene family MIPF0000225; mir-286
Literature search

2 open access papers mention aga-mir-286
(14 sentences)

Stem-loop
      -auaa         --au   -   a          --uc c gu a 
5' guc     uuuggggcg    ugu cgg cuagucgcug    g a  c u
   |||     |||||||||    ||| ||| ||||||||||    | |  |  
3' cag     aaauccugc    aca gcc gaucagugau    c u  g u
      caagc         gcuc   a   a          ucca u ug c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
chr3R: 43009395-43009490 [-]
intergenic
Database links

Mature sequence aga-miR-286

Accession MIMAT0010110
Sequence

61 - 

ugacuagaccgaacacucgcguc

 - 83

Get sequence
Evidence by similarity; MI0000380

References

1
" Griffiths-Jones S Unpublished (2009).