Stem-loop sequence aga-mir-1000

AccessionMI0010604 (change log)
DescriptionAnopheles gambiae miR-1000 stem loop
Gene family MIPF0000701; mir-1000
Literature search

2 open access papers mention aga-mir-1000
(11 sentences)

Stem-loop
   --------      a       au u       uc         cu  uu 
5'         ccuagc gucgaug  a uguccug  acagcagua  uu  g
           |||||| |||||||  | |||||||  |||||||||  ||   
3'         ggaucg cagcuac  u acagggc  uguugucau  ga  c
   uacuuuug      -       cu u       uu         uu  uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
chr2R: 13241765-13241857 [+]
intergenic
Database links

Mature sequence aga-miR-1000

Accession MIMAT0010109
Sequence

15 - 

auauuguccugucacagcagu

 - 35

Get sequence
Evidence by similarity; MI0005862

References

1
" Griffiths-Jones S Unpublished (2009).