Stem-loop sequence aga-mir-965-2

Accession MI0010603
Description Anopheles gambiae miR-965-2 stem loop
Gene family MIPF0000708; mir-965
Stem-loop
   cgaa  aaau        u     a      u       a  c    u c  a 
5'     gu    cgacgaau cugaa ggggaa gcuguac cu uaug g ua a
       ||    |||||||| ||||| |||||| ||||||| || |||| | ||  
3'     cg    guugcuug gauuu cccuuu cgauaug ga auac c au a
   -aaa  -agc        c     a      u       c  -    - u  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
chr3R: 11101688-11101791 [+]
intergenic

Mature sequence aga-miR-965

Accession MIMAT0010108
Sequence

63 - 

uaagcguauagcuuuucccauu

 - 84

Get sequence
Evidence by similarity; MI0005821

References

1
" Griffiths-Jones S Unpublished (2009).