Stem-loop sequence aga-mir-965-2

AccessionMI0010603 (change log)
DescriptionAnopheles gambiae miR-965-2 stem loop
Gene family MIPF0000708; mir-965
Stem-loop
   cgaa  aaau        u     a      u       a  c    u c  a 
5'     gu    cgacgaau cugaa ggggaa gcuguac cu uaug g ua a
       ||    |||||||| ||||| |||||| ||||||| || |||| | ||  
3'     cg    guugcuug gauuu cccuuu cgauaug ga auac c au a
   -aaa  -agc        c     a      u       c  -    - u  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
chr3R: 11101688-11101791 [+]
intergenic
Database links

Mature sequence aga-miR-965-5p

Accession MIMAT0037353
Sequence

25 - 

aggggaaugcuguacacucua

 - 45

Get sequence
Evidence experimental; Illumina [1]

Mature sequence aga-miR-965-3p

Accession MIMAT0010108
Sequence

63 - 

uaagcguauagcuuuucccauu

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
" Griffiths-Jones S Unpublished (2009).
2
PMID:25766668 "The germline of the malaria mosquito produces abundant miRNAs, endo-siRNAs, piRNAs and 29-nt small RNAs" Castellano L, Rizzi E, Krell J, Di Cristina M, Galizi R, Mori A, Tam J, De Bellis G, Stebbing J, Crisanti A, Nolan T BMC Genomics. 16:100(2015).