Stem-loop sequence aga-mir-957

AccessionMI0010600 (change log)
DescriptionAnopheles gambiae miR-957 stem loop
Gene family MIPF0000723; mir-957
Literature search

1 open access papers mention aga-mir-957
(1 sentences)

Stem-loop
   -      -    gu  g              g        uau   g 
5'  ugauca cugc  gc uuaguuuugggcgg uuuuagug   uuc a
    |||||| ||||  || |||||||||||||| ||||||||   ||| u
3'  auuggu gacg  cg agucaaaaccugcc aaaguuau   aag g
   c      a    gu  g              -        cuu   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
chr3L: 14911228-14911321 [+]
intergenic
Database links

Mature sequence aga-miR-957

Accession MIMAT0010106
Sequence

59 - 

ugaaaccguccaaaacugaggc

 - 80

Get sequence
Evidence by similarity; MI0005811

References

1
" Griffiths-Jones S Unpublished (2009).