Stem-loop sequence aga-mir-927

AccessionMI0010596 (change log)
DescriptionAnopheles gambiae miR-927 stem loop
Gene family MIPF0000452; mir-927
Literature search

1 open access papers mention aga-mir-927
(1 sentences)

Stem-loop
   --ua       g               cu       ac    g      
5'     guuaaug uuuguuuuagaauuc  acgcuuu  ccgu auuaa 
       ||||||| |||||||||||||||  |||||||  |||| |||| a
3'     caauugc aagcaaagucuuagg  ugcgaaa  ggcg ugaug 
   gcaa       a               uu       -c    -      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
chrX: 18737368-18737460 [+]
intergenic
Database links

Mature sequence aga-miR-927

Accession MIMAT0010102
Sequence

16 - 

uuuagaauuccuacgcuuuacc

 - 37

Get sequence
Evidence by similarity; MI0005843

References

1
" Griffiths-Jones S Unpublished (2009).