Stem-loop sequence tca-mir-1000

AccessionMI0010591 (change log)
DescriptionTribolium castaneum miR-1000 stem loop
Gene family MIPF0000701; mir-1000
Stem-loop
   ----------------ac            auau       uca        -  - g 
5'                   ggcucggccaug    uguccug   cagcagua cu g u
                     ||||||||||||    |||||||   |||||||| || |  
3'                   ccgggccgguac    acagggc   gucgucau ga c u
   cccgccgcagccgguucu            cagu       uuc        u  g c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
ChLG2: 1618878-1618977 [+]
intergenic
Database links

Mature sequence tca-miR-1000-5p

Accession MIMAT0010097
Previous IDstca-miR-1000
Sequence

15 - 

auauuguccugucacagc

 - 32

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-1000-3p

Accession MIMAT0019184
Sequence

51 - 

cugcugcuucgggacaugacca

 - 72

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
" Griffiths-Jones S Unpublished (2009).
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).