Stem-loop sequence tca-mir-965

AccessionMI0010589 (change log)
DescriptionTribolium castaneum miR-965 stem loop
Gene family MIPF0000708; mir-965
Stem-loop
   -gg  -  cucc       -  cu    u            c   g   -  -  u 
5'    cg cg    gauugga cc  gggg ggaaaguuguac gcu aug gu ga u
      || ||    ||||||| ||  |||| |||||||||||| ||| ||| || ||  
3'    gc gc    cuaaccu gg  uccc cuuuucgauaug cga uac ca cu u
   cua  a  ---a       u  uu    -            -   a   a  u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
ChLG5: 8033620-8033723 [+]
intergenic
Database links

Mature sequence tca-miR-965-5p

Accession MIMAT0019183
Sequence

24 - 

gguggaaaguuguaccgcu

 - 42

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-965-3p

Accession MIMAT0010095
Previous IDstca-miR-965
Sequence

63 - 

uaagcguauagcuuuuccccuu

 - 84

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
" Griffiths-Jones S Unpublished (2009).
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).