Stem-loop sequence tca-mir-993

AccessionMI0010588 (change log)
DescriptionTribolium castaneum miR-993 stem loop
Gene family MIPF0000033; mir-10
Stem-loop
   ggca         uc    c      uc          uagaau 
5'     cauccguga  uacc uguaga  cgggcuuuug      u
       |||||||||  |||| ||||||  ||||||||||       
3'     guaggcauu  augg acaucu  gcucgaagac      u
   -aag         cu    -      cu          uagauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
ChLG2: 8141702-8141789 [-]
intergenic
Database links

Mature sequence tca-miR-993-5p

Accession MIMAT0019182
Sequence

16 - 

uacccuguagauccgggcuu

 - 35

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-993-3p

Accession MIMAT0010094
Previous IDstca-miR-993
Sequence

55 - 

gaagcucgucucuacagguaucu

 - 77

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
" Griffiths-Jones S Unpublished (2009).
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).