Stem-loop sequence tca-mir-279b

AccessionMI0010587 (change log)
DescriptionTribolium castaneum miR-279b stem loop
Gene family MIPF0000184; mir-279
Literature search

2 open access papers mention tca-mir-279b
(8 sentences)

Stem-loop
   gguaguuauc     g    u        a         g    u  ua 
5'           cuaaa uuuu gaugggug ggguuuggu caug uu  u
             ||||| |||| |||||||| ||||||||| |||| ||   
3'           gguuu aaaa cuacucac ccuagauca guac aa  u
   -------ugu     a    c        a         -    u  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
ChLG5: 297455-297546 [-]
intergenic
Database links

Mature sequence tca-miR-279b-5p

Accession MIMAT0019181
Sequence

22 - 

gaugggugaggguuuggugcaug

 - 44

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-279b-3p

Accession MIMAT0010201
Previous IDstca-miR-279b
Sequence

59 - 

ugacuagauccacacucaucca

 - 80

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
" Griffiths-Jones S Unpublished (2009).
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).