Stem-loop sequence tca-mir-263a

AccessionMI0010586 (change log)
DescriptionTribolium castaneum miR-263a stem loop
Gene family MIPF0000122; mir-263
Stem-loop
   guga   ua   -   c a        g    aa        -  uc 
5'     gca  ggc cug g auggcacu gaag  uucacggg gu  u
       |||  ||| ||| | |||||||| ||||  |||||||| ||  u
3'     ugu  ccg gac c uaccguga uuuc  aggugccc ca  c
   --cc   uc   a   u c        g    --        u  cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
ChLG5: 13054978-13055068 [-]
intergenic
Database links

Mature sequence tca-miR-263a-5p

Accession MIMAT0010093
Previous IDstca-miR-263a
Sequence

18 - 

aauggcacuggaagaauucacggg

 - 41

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-263a-3p

Accession MIMAT0019180
Sequence

56 - 

cguggacuuugagugccauccuc

 - 78

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
" Griffiths-Jones S Unpublished (2009).
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).