Stem-loop sequence tca-mir-970

AccessionMI0010585 (change log)
DescriptionTribolium castaneum miR-970 stem loop
Gene family MIPF0000700; mir-970
Literature search

1 open access papers mention tca-mir-970
(1 sentences)

Stem-loop
   aaac  u       gc    ca         guac       guua 
5'     ga gccggcg  agcu  gcguguguc    ugauagu    u
       || |||||||  ||||  |||||||||    |||||||     
3'     cu uggccgc  ucgg  cgcacacag    acuaucg    c
   uccu  c       ua    --         -aau       auca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
ChLG2: 10499950-10500040 [+]
intergenic
Database links

Mature sequence tca-miR-970-5p

Accession MIMAT0019179
Sequence

17 - 

agcucagcgugugucguacugaua

 - 40

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-970-3p

Accession MIMAT0010092
Previous IDstca-miR-970
Sequence

57 - 

ucauaagacacacgcggcuau

 - 77

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
" Griffiths-Jones S Unpublished (2009).
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).