Stem-loop sequence tca-bantam

AccessionMI0010584 (change log)
DescriptionTribolium castaneum bantam stem loop
Gene family MIPF0000153; bantam
Literature search

2 open access papers mention tca-bantam
(4 sentences)

Stem-loop
   ucagc   a     cu                 ga    uaua 
5'      gag cgaaa  gguuuucacagugauuu  caga    u
        ||| |||||  |||||||||||||||||  ||||     
3'      cuu guuuu  ucgaaaguguuacuaga  gucu    u
   ----a   -     ag                 --    uagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
ChLG3: 17668731-17668811 [-]
intergenic
Database links

Mature sequence tca-bantam-5p

Accession MIMAT0019178
Sequence

15 - 

cugguuuucacagugauuugacag

 - 38

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-bantam-3p

Accession MIMAT0010091
Previous IDstca-bantam
Sequence

52 - 

ugagaucauugugaaagcugauu

 - 74

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
" Griffiths-Jones S Unpublished (2009).
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).