Stem-loop sequence tca-mir-9a

AccessionMI0010583 (change log)
DescriptionTribolium castaneum miR-9a stem loop
Gene family MIPF0000014; mir-9
Literature search

1 open access papers mention tca-mir-9a
(3 sentences)

Stem-loop
   -   aua  uu       u        g     --g    g 
5'  cug   uu  cuuuggu aucuagcu uauga   uauu u
    |||   ||  ||||||| |||||||| |||||   ||||  
3'  gac   aa  gaggcca uggaucga auacu   auaa u
   u   caa  uu       u        a     aca    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tca-miR-9a-5p

Accession MIMAT0010090
Previous IDstca-miR-9a
Sequence

10 - 

ucuuugguuaucuagcuguau

 - 30

Get sequence
Evidence experimental; SOLID [1]
Database links

Mature sequence tca-miR-9a-3p

Accession MIMAT0019177
Sequence

51 - 

auaaagcuagguuaccggag

 - 70

Get sequence
Evidence experimental; SOLID [1]
Database links

References

1
" Griffiths-Jones S Unpublished (2009).
2
PMID:20817720 "Functional shifts in insect microRNA evolution" Marco A, Hui JH, Ronshaugen M, Griffiths-Jones S Genome Biol Evol. 2:686-696(2010).