Stem-loop sequence gma-MIR396c

AccessionMI0010572 (change log)
DescriptionGlycine max miR396c stem-loop
Gene family MIPF0000047; MIR396
Literature search

25 open access papers mention gma-MIR396c
(145 sentences)

Stem-loop
   caac        ------u    c         gc              u     uagug  a 
5'     aaguccug       uaug uuuuccaca  uuucuugaacuucu augcc     ca u
       ||||||||       |||| |||||||||  |||||||||||||| |||||     || u
3'     uucaggau       guac aaaaggugu  aaagaauuugaaga uacgg     gu a
   ----        cuaaacu    a         aa              -     -ugua  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr13: 45239131-45239247 [+]
intergenic
Database links

Mature sequence gma-miR396c

Accession MIMAT0010079
Sequence

21 - 

uuccacagcuuucuugaacuu

 - 41

Get sequence
Evidence experimental; cloned [1], 454 [2]

References

1
PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).
2
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).