Stem-loop sequence gma-MIR167d

AccessionMI0010571 (change log)
DescriptionGlycine max miR167d stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

26 open access papers mention gma-MIR167d
(191 sentences)

Stem-loop
   aagg   -a   --     aa     a   -  -             cuuu       gggagc 
5'     guc  caa  gggaa  aguga gcu gc cagcaugaucuag    gguuagu      c
       |||  |||  |||||  ||||| ||| || |||||||||||||    |||||||       
3'     cag  guu  uccuu  ucacu cga cg gucguacuggauc    ccaaucg      a
   ----   ag   ua     cc     c   u  u             acuc       ugagag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr10: 2648276-2648396 [+]
intergenic
Database links

Mature sequence gma-miR167d

Accession MIMAT0010078
Sequence

21 - 

ugaagcugccagcaugaucua

 - 41

Get sequence
Evidence experimental; cloned [1], 454 [2], SOLiD [3]

References

1
PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).
2
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
3