Stem-loop sequence zma-MIR396d

AccessionMI0010570 (change log)
DescriptionZea mays miR396d stem-loop
Gene family MIPF0000047; MIR396
Literature search

23 open access papers mention zma-MIR396d
(79 sentences)

Stem-loop
   ---- g     --  uuu    ag   uu  ugaa ug  a 
5'     c ggcau  gc   ccac  gcu  cu    c  ug a
       | |||||  ||   ||||  |||  ||    |  ||  
3'     g ucgug  cg   ggug  ugg  gg    g  gc c
   ugug g     gu  --u    -g   -u  ugcg gu  u 
Get sequence
Deep sequencing
8094 reads, 3.72e+03 reads per million, 204 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr10: 148727703-148727776 [+]
intergenic
Database links

Mature sequence zma-miR396d

Accession MIMAT0010077
Sequence

11 - 

uuccacaggcuuucuugaacug

 - 32

Get sequence
Deep sequencing6292 reads, 193 experiments
Evidence experimental; Illumina [1-2]
Database links

References

1
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).