Stem-loop sequence zma-MIR396c

AccessionMI0010569 (change log)
DescriptionZea mays miR396c stem-loop
Gene family MIPF0000047; MIR396
Literature search

22 open access papers mention zma-MIR396c
(82 sentences)

Stem-loop
   -       g  u   -   g   u  uugaa ug  a 
5'  cgggcau cu ucc aca gcu uc     c  ug a
    ||||||| || ||| ||| ||| ||     |  ||  
3'  guucgua gg agg ugu ugg gg     g  gc c
   g       a  u   c   a   u  uggug gu  u 
Get sequence
Deep sequencing
7438 reads, 3.32e+03 reads per million, 196 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (B73_RefGen_v4; GCA_000005005.6) Overlapping transcripts
chr2: 1951700-1951773 [-]
intergenic
Database links

Mature sequence zma-miR396c

Accession MIMAT0010076
Sequence

11 - 

uuccacaggcuuucuugaacug

 - 32

Get sequence
Deep sequencing6292 reads, 193 experiments
Evidence experimental; Illumina [1-2]
Database links

References

1
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).
2
PMID:19936050 "A genome-wide characterization of microRNA genes in maize" Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D PLoS Genet. 5:e1000716(2009).