Stem-loop sequence osa-MIR2106

AccessionMI0010567 (change log)
DescriptionOryza sativa miR2106 stem-loop
Literature search

2 open access papers mention osa-MIR2106
(4 sentences)

Stem-loop
   ---u   agaa      -   -          uac     --uga  u 
5'     gcg    ggaugu ucc gagaaucucg   gccgg     gg u
       |||    |||||| ||| ||||||||||   |||||     ||  
3'     cgc    cuuaca agg cuuuuggagc   cgguc     cc u
   aagg   --aa      u   u          ---     uagug  c 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 23768609-23768694 [-]
intergenic
Database links

Mature sequence osa-miR2106

Accession MIMAT0010074
Sequence

56 - 

ccgagguuuucuggauacauu

 - 76

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).