Stem-loop sequence osa-MIR2105

AccessionMI0010566 (change log)
DescriptionOryza sativa miR2105 stem-loop
Literature search

1 open access papers mention osa-MIR2105
(1 sentences)

Stem-loop
   -  ug    u    ug     -     a      ga uu u 
5'  uu  gauc guga  uauuu cauua gaauuu  g  g a
    ||  |||| ||||  ||||| ||||| ||||||  |  | u
3'  gg  uuag uacu  guaag guagu uuuaag  u  u u
   a  gu    u    ua     u     g      ag uu u 
Get sequence
Deep sequencing
9 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 4602439-4602521 [+]
intergenic
Database links

Mature sequence osa-miR2105

Accession MIMAT0010073
Sequence

54 - 

uugugaugugaaugauucau

 - 73

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).