Stem-loop sequence osa-MIR2103

AccessionMI0010564 (change log)
DescriptionOryza sativa miR2103 stem-loop
Literature search

1 open access papers mention osa-MIR2103
(1 sentences)

Stem-loop
   cggc     -----        u   u   - ---g      g 
5'     gccuu     uuucccuc ccg gcg c    cucgcc g
       |||||     |||||||| ||| ||| |    ||||||  
3'     cggag     agagggag ggc cgu g    gagcgg c
   ----     aacag        -   -   a guag      c 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 16852565-16852637 [-]
intergenic
Database links

Mature sequence osa-miR2103

Accession MIMAT0010071
Sequence

10 - 

uuucccucuccgugcgcgcucg

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).