Stem-loop sequence osa-MIR396f

AccessionMI0010563 (change log)
DescriptionOryza sativa miR396f stem-loop
Gene family MIPF0000047; MIR396
Literature search

54 open access papers mention osa-MIR396f
(136 sentences)

Stem-loop
   -      cuc    ca                g   ucgugugugcaugcuccucauauauuguucuagaucccaugcaugaugcau 
5'  gccaug   ucca  ggcuuucuugaacugu aac                                                   a
    ||||||   ||||  |||||||||||||||| |||                                                   u
3'  ugguac   aggu  cugaaagaacuugaua uug                                                   c
   g      aaa    uc                g   uucuaccccuaggucuacgcguagcuacuggauuaagucuagucuagcuag 
Get sequence
Deep sequencing
2282 reads, 1.35e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 35636546-35636721 [-]
intergenic
Database links

Mature sequence osa-miR396f-5p

Accession MIMAT0010070
Previous IDsosa-miR396f
Sequence

8 - 

ucuccacaggcuuucuugaacu

 - 29

Get sequence
Deep sequencing2131 reads, 2 experiments
Evidence experimental; Illumina [1-2]
Database links

Mature sequence osa-miR396f-3p

Accession MIMAT0015292
Sequence

145 - 

auaguucaagaaaguccuuggaaa

 - 168

Get sequence
Deep sequencing151 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

References

1
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).
2
PMID:19903869 "Rice MicroRNA effector complexes and targets" Wu L, Zhang Q, Zhou H, Ni F, Wu X, Qi Y Plant Cell. 21:3421-3435(2009).