Stem-loop sequence osa-MIR2101

AccessionMI0010561 (change log)
DescriptionOryza sativa miR2101 stem-loop
Literature search

2 open access papers mention osa-MIR2101
(2 sentences)

Stem-loop
   -ucuua  u    -       --a       a   ggag     gguauacaaccc 
5'       uc caca uguuuac   aguuaaa ugu    cagag            a
         || |||| |||||||   ||||||| |||    |||||             
3'       ag gugu acgagug   ucaauuu gca    gucuc            a
   uaccgg  c    u       aac       a   ---a     acgguuugaaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 17986691-17986797 [+]
intergenic
Database links

Mature sequence osa-miR2101-5p

Accession MIMAT0010066
Sequence

10 - 

acauguuuacaaguuaaaaugu

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence osa-miR2101-3p

Accession MIMAT0010067
Sequence

76 - 

auuuaacucaagugagcauugu

 - 97

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).