Stem-loop sequence osa-MIR2100

AccessionMI0010560 (change log)
DescriptionOryza sativa miR2100 stem-loop
Stem-loop
   u    -     u  ag     -     a  caa     caaacaagccguaggguggguggggaagaucggaagaagc 
5'  uccc uucuc ca  uugcc aaaca gc   guugc                                        g
    |||| ||||| ||  ||||| ||||| ||   |||||                                        g
3'  aggg gaggg gu  ggcgg uuugu cg   caaug                                        c
   a    u     -  ga     a     -  --c     ucuuucucuagccauuuuucuuuuuuuuaucgcuagcuca 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr11: 16194999-16195151 [-]
intergenic
Database links

Mature sequence osa-miR2100-5p

Accession MIMAT0010064
Sequence

6 - 

uucucucaaguugccaaacaag

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence osa-miR2100-3p

Accession MIMAT0010065
Sequence

122 - 

aaccgcuguuuaggcggagugg

 - 143

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).