Stem-loop sequence osa-MIR2099

AccessionMI0010559 (change log)
DescriptionOryza sativa miR2099 stem-loop
Literature search

1 open access papers mention osa-MIR2099
(1 sentences)

Stem-loop
   --        u     -   uug    a    u 
5'   cugcuuug gaaua ugu   uaca gcuu a
     |||||||| ||||| |||   |||| ||||  
3'   gacgagac cuuau gcg   augu cgaa c
   uu        -     u   ---    -    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 42570854-42570913 [+]
intergenic
Database links

Mature sequence osa-miR2099-5p

Accession MIMAT0010062
Sequence

9 - 

ugaauauguuuguacaagcuuu

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence osa-miR2099-3p

Accession MIMAT0010063
Sequence

31 - 

acaaagcuguagcguuauuc

 - 50

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).