Stem-loop sequence osa-MIR2098

AccessionMI0010558 (change log)
DescriptionOryza sativa miR2098 stem-loop
Literature search

1 open access papers mention osa-MIR2098
(1 sentences)

Stem-loop
   -cagucuu    c     c  gga     -   a     
5'         gugc auucc gu   ggcag ccg ugag 
           |||| ||||| ||   ||||| ||| ||| g
3'         cacg ugagg cg   cuguu ggc auua 
   guaaucuu    -     -  -aa     u   a     
Get sequence
Deep sequencing
2 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr10: 18080242-18080313 [-]
intergenic
Database links

Mature sequence osa-miR2098-5p

Accession MIMAT0010060
Sequence

15 - 

ucccguggaggcagccgaug

 - 34

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence osa-miR2098-3p

Accession MIMAT0010061
Sequence

43 - 

cgguuugucaagcggagugc

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).