Stem-loop sequence osa-MIR2096

AccessionMI0010556 (change log)
DescriptionOryza sativa miR2096 stem-loop
Literature search

2 open access papers mention osa-MIR2096
(3 sentences)

Stem-loop
   --      gca              c                    g  gccg           a      gcgagaauucacugaaauuaccgcgccaucuuaucuccgcaaguugaagaa 
5'   gacgcc   cugccgauuucccc ucgggcgagccaucggagcg gg    uuggcucccaa gcagac                                                   u
     ||||||   |||||||||||||| |||||||||||||||||||| ||    ||||||||||| ||||||                                                    
3'   uugcgg   ggcggcuaaagggg aguccgcucgguagcuuugc cc    aaccgaggguu cgucug                                                   a
   gu      -ag              -                    g  ----           -      uauacaucaucaucuguguacuuaagugauuuuuaaugacgcgggcuuaau 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 6443388-6443624 [+]
intergenic
Database links

Mature sequence osa-miR2096-5p

Accession MIMAT0010056
Sequence

11 - 

ugccgauuucccccucgggcg

 - 31

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence osa-miR2096-3p

Accession MIMAT0010057
Sequence

209 - 

ccugaggggaaaucggcggga

 - 229

Get sequence
Deep sequencing5 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).