Stem-loop sequence osa-MIR2095

AccessionMI0010555 (change log)
DescriptionOryza sativa miR2095 stem-loop
Stem-loop
   -    aacug   auu   cg      a        uagau  a 
5'  guga     aua   uua  augaau gaagguua     gu g
    ||||     |||   |||  |||||| ||||||||     ||  
3'  cacu     uau   aau  uauuua cuucuaau     ca u
   a    cauaa   --g   ag      c        uuaau  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr10: 5931460-5931546 [+]
intergenic
Database links

Mature sequence osa-miR2095-5p

Accession MIMAT0010054
Sequence

7 - 

cugauaauuuuacgaugaauag

 - 28

Get sequence
Evidence experimental; Illumina [1]

Mature sequence osa-miR2095-3p

Accession MIMAT0010055
Sequence

58 - 

cuuccauuuaugauaaguau

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).