Stem-loop sequence osa-MIR2094

AccessionMI0010554 (change log)
DescriptionOryza sativa miR2094 stem-loop
Literature search

3 open access papers mention osa-MIR2094
(3 sentences)

Stem-loop
   ----   gga  agu    c     -     c  g   c 
5'     ucg   ga   gugg ugcua ggcuc ug gug a
       |||   ||   |||| ||||| ||||| || |||  
3'     agc   cu   cacc acggu ucgag ac cac a
   cggu   gag  --g    u     g     -  a   c 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 29779638-29779709 [+]
intergenic
Database links

Mature sequence osa-miR2094-5p

Accession MIMAT0010052
Sequence

13 - 

uggcugcuaggcuccugggug

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence osa-miR2094-3p

Accession MIMAT0010053
Sequence

42 - 

cagagcuguggcauccacgucg

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).