Stem-loop sequence osa-MIR2093

AccessionMI0010553 (change log)
DescriptionOryza sativa miR2093 stem-loop
Literature search

2 open access papers mention osa-MIR2093
(3 sentences)

Stem-loop
   a  -   ugu                 a 
5'  cu gga   gugcauuaauuggaaga c
    || |||   ||||||||||||||||| a
3'  ga ccu   uacguaauuaaccuucu c
   a  u   ucu                 a 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr5: 16056024-16056081 [-]
intergenic
Database links

Mature sequence osa-miR2093-5p

Accession MIMAT0010050
Sequence

10 - 

gugcauuaauuggaagaaca

 - 29

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence osa-miR2093-3p

Accession MIMAT0010051
Sequence

29 - 

acaucuuccaauuaaugcau

 - 48

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).