Stem-loop sequence osa-MIR2092

AccessionMI0010552 (change log)
DescriptionOryza sativa miR2092 stem-loop
Stem-loop
   uug     --    cu   -  c     u    ccc    ga     cacuacu 
5'    aucuc  ccaa  gaa gu ggugu uacu   acaa  ugaua       a
      |||||  ||||  ||| || ||||| ||||   ||||  |||||       g
3'    uggag  gguu  cuu cg ccaca auga   uguu  acuau       u
   -ug     ac    ac   a  a     c    ---    -a     ucccacc 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 10116323-10116425 [+]
intergenic
Database links

Mature sequence osa-miR2092-5p

Accession MIMAT0010048
Sequence

10 - 

caacugaagucgguguuuacu

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence osa-miR2092-3p

Accession MIMAT0010049
Sequence

79 - 

accagcauuccauuggcagagg

 - 100

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).