Stem-loop sequence osa-MIR2091

AccessionMI0010551 (change log)
DescriptionOryza sativa miR2091 stem-loop
Stem-loop
   -ga    aa       gagg       c   cg    gu    gu 
5'    gcuc  ccgagcc    aggaggc aug  ugcg  ggcu  g
      ||||  |||||||    ||||||| |||  ||||  ||||   
3'    cgag  gguucgg    uccuccg uac  acgu  ccga  g
   cga    gc       ---a       u   au    --    ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 19403368-19403453 [-]
intergenic
Database links

Mature sequence osa-miR2091-5p

Accession MIMAT0010046
Sequence

5 - 

ucaaccgagccgaggaggagg

 - 25

Get sequence
Deep sequencing11 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence osa-miR2091-3p

Accession MIMAT0010047
Sequence

55 - 

cauacauugccuccuaggcuug

 - 76

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).