Stem-loop sequence osa-MIR2090

AccessionMI0010550 (change log)
DescriptionOryza sativa miR2090 stem-loop
Literature search

1 open access papers mention osa-MIR2090
(1 sentences)

Stem-loop
   auuauuaac         a                 c -agg   agaacg 
5'          ucugauucu gaauuuuugcguuaaag g    acg      a
            ||||||||| ||||||||||||||||| |    |||       
3'          aggcuaaga cuuaaaaacgcaauuuc c    ugu      a
   ccuauuccu         c                 a agaa   cacaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 38764289-38764391 [-]
intergenic
Database links

Mature sequence osa-miR2090

Accession MIMAT0010045
Sequence

7 - 

aacucugauucuagaauuuuug

 - 28

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).