Stem-loop sequence osa-MIR1846e

AccessionMI0010547 (change log)
DescriptionOryza sativa miR1846e stem-loop
Gene family MIPF0000577; MIR1846
Literature search

10 open access papers mention osa-MIR1846e
(14 sentences)

Stem-loop
   -  c   c   aa             ac     g 
5'  cg auc gcc  cgaggaggccggg  caccg a
    || ||| |||  |||||||||||||  |||||  
3'  gc uag cgg  gcuccuccggccu  guggc u
   g  c   a   cc             ca     c 
Get sequence
Deep sequencing
113 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr9: 13211437-13211505 [-]
intergenic
Database links

Mature sequence osa-miR1846e

Accession MIMAT0010042
Sequence

10 - 

caacgaggaggccgggacca

 - 29

Get sequence
Deep sequencing109 reads, 2 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:19103661 "Characterization and expression profiles of miRNAs in rice seeds" Xue LJ, Zhang JJ, Xue HW Nucleic Acids Res. 37:916-930(2009).