Stem-loop sequence mtr-MIR2089

AccessionMI0010546 (change log)
DescriptionMedicago truncatula miR2089 stem-loop
Gene family MIPF0000703; MIR1510
Literature search

1 open access papers mention mtr-MIR2089
(2 sentences)

Stem-loop
           ccaagcauucaaga     a     au  a           c         c  ug    ug u    agau 
5' gcaggcaa              ucuag gcaag  uu uuuuaccuauu caccaauuc au  aucc  g uuca    c
   ||||||||              ||||| |||||  || ||||||||||| ||||||||| ||  ||||  | ||||    u
3' cguuuguu              agauc cguuc  aa aaaauggauaa gugguuagg ua  uagg  c aagu    g
           uauauauaaaacga     a     ac  c           u         a  ug    gu u    gaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 18629430-18629592 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR2089
mtr-MIR2592jchr5: 18620902-18621150 [+]
mtr-MIR2089chr5: 18629430-18629592 [+]
Database links

Mature sequence mtr-miR2089-5p

Accession MIMAT0010040
Previous IDsmtr-miR2089
Sequence

41 - 

uuaccuauuccaccaauuccau

 - 62

Get sequence
Evidence experimental; Illumina [1], Northern [1]

Mature sequence mtr-miR2089-3p

Accession MIMAT0010041
Previous IDsmtr-miR2089*
Sequence

104 - 

aggauugguguaauagguaaaa

 - 125

Get sequence
Evidence experimental; Illumina [1], Northern [1]

References

1
PMID:19068109 "High-throughput sequencing of Medicago truncatula short RNAs identifies eight new miRNA families" Szittya G, Moxon S, Santos DM, Jing R, Fevereiro MP, Moulton V, Dalmay T BMC Genomics. 9:593(2008).