![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mtr-MIR2088 |
|||||
Accession | MI0010545 (change log) | ||||
Previous IDs | mtr-MIR2088 | ||||
Description | Medicago truncatula miR2088 stem-loop | ||||
Stem-loop |
gua uc guagac c c aaaac cca ug 5' ucucu uc gaa gg ggcuuaac gauguaggccuagauuacauuggac agu aacu a ||||| || ||| || |||||||| ||||||||||||||||||||||||| ||| |||| 3' agaga ag cuu uc cugaauug cuacaucuggaucuaauguaaccug uca uugg g --a -u augaaa u u guucu --- ua |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence mtr-miR2088-5p |
|
Accession | MIMAT0010038 |
Previous IDs | mtr-miR2088;mtr-miR2088a |
Sequence |
39 - aggccuagauuacauuggac - 58 |
Evidence | experimental; Illumina [1,3], Northern [1], 454 [2] |
Mature sequence mtr-miR2088-3p |
|
Accession | MIMAT0010039 |
Previous IDs | mtr-miR2088*;mtr-miR2088a* |
Sequence |
93 - uccaauguaaucuaggucua - 112 |
Evidence | experimental; Illumina [1,3], Northern [1], 454 [2] |
References |
|
1 |
PMID:19068109
"High-throughput sequencing of Medicago truncatula short RNAs identifies eight new miRNA families"
BMC Genomics. 9:593(2008).
|
2 |
PMID:19767456
"Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules"
Plant Cell. 21:2780-2796(2009).
|
3 |
PMID:23572382
"microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula"
Planta. 238:91-105(2013).
|