Stem-loop sequence mtr-MIR2087

AccessionMI0010544 (change log)
DescriptionMedicago truncatula miR2087 stem-loop
Gene family MIPF0000824; MIR2629
Stem-loop
      ugau     c    c                a   a               a             a      a   u             ag                       agugu    uuuuuu 
5' gcu    gaaaa ugcu uugacacauaugauag gcu aaaaacauauguaaa gacgaaaaugccc uguagc guu acuaccgaaguaa  aaccggcugcaguuaacugcuga     gaag      u
   |||    ||||| |||| |||||||||||||||| ||| ||||||||||||||| ||||||||||||| |||||| ||| |||||||||||||  |||||||||||||||||||||||     ||||      u
3' cga    cuuuu acga aacuguguauacuauc cga uuuuuguguacauuu cugcuuuuacggg acguug caa ugauggcuucauu  uuggcugacgucaauugacggcu     uuuc      u
      ---u     a    c                c   c               a             g      c   u             cu                       -gcuu    uuuuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr2: 13519918-13520182 [-]
intergenic
Database links

Mature sequence mtr-miR2087-5p

Accession MIMAT0010036
Previous IDsmtr-miR2087
Sequence

87 - 

gaaguaaagaaccggcugcag

 - 107

Get sequence
Evidence experimental; Illumina [1-2], Northern [1]

Mature sequence mtr-miR2087-3p

Accession MIMAT0010037
Previous IDsmtr-miR2087*
Sequence

162 - 

cugcagucgguuucuuacuuc

 - 182

Get sequence
Evidence experimental; Illumina [1-2], Northern [1]

References

1
PMID:19068109 "High-throughput sequencing of Medicago truncatula short RNAs identifies eight new miRNA families" Szittya G, Moxon S, Santos DM, Jing R, Fevereiro MP, Moulton V, Dalmay T BMC Genomics. 9:593(2008).
2
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).