Stem-loop sequence ppt-MIR1023e

AccessionMI0010538 (change log)
DescriptionPhyscomitrella patens miR1023e stem-loop
Gene family MIPF0000396; MIR1023
Stem-loop
   ---ac     u aau     c  a      cu   u           aucguu     ccuc 
5'      agcuu g   gucau au cacucu  ccg uucccuuccga      uuucc    a
        ||||| |   ||||| || ||||||  ||| |||||||||||      |||||    u
3'      ucgaa c   uagua ua gugagg  ggc aagggaagguu      aaagg    g
   cagcc     - guc     c  c      ug   u           ---guc     ucac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr10: 3221227-3221346 [-]
intergenic
Clustered miRNAs
< 10kb from ppt-MIR1023e
ppt-MIR1023cChr10: 3231102-3231269 [+]
ppt-MIR1023eChr10: 3221227-3221346 [-]
Database links

Mature sequence ppt-miR1023e-5p

Accession MIMAT0010024
Sequence

21 - 

acacucucuccguuucccuuc

 - 41

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppt-miR1023e-3p

Accession MIMAT0010025
Sequence

80 - 

agggaaucggguggagugcau

 - 100

Get sequence
Evidence experimental; Illumina [1]

References

1