Stem-loop sequence ppt-MIR2083

AccessionMI0010537 (change log)
DescriptionPhyscomitrella patens miR2083 stem-loop
Gene family MIPF0000996; MIR899
Stem-loop
   aaaaguguguguaugcggaaguuggagaaaacccagacuucauugcucgaugaagcauguagcuucgcagucgua            c  c          u uc   cgcauugugguucuccaacaccugcacagcggcggucuuguccggauuagggaucgucuacaccagauaagccacg 
5'                                                                            cuucuugcacuc uc aucucucgca c  uug                                                                            g
                                                                              |||||||||||| || |||||||||| |  |||                                                                            c
3'                                                                            gaagaacgugag ag uagagagugu g  gac                                                                            g
   --------------------------------------------------acgcagaccuuguaccuuucuccca            c  u          c uu   ccgucccaacauaggcuugcaccuuuugcgucguuggcaacaacuugguuuccuaccauaaaaagaggcucuuuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ppt-miR2083-5p

Accession MIMAT0010022
Sequence

77 - 

uucuugcacuccuccaucucu

 - 97

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppt-miR2083-3p

Accession MIMAT0010023
Sequence

277 - 

agauugacgagugcaagaaga

 - 297

Get sequence
Evidence experimental; Illumina [1]

References

1