Stem-loop sequence ppt-MIR2082

AccessionMI0010536 (change log)
DescriptionPhyscomitrella patens miR2082 stem-loop
Stem-loop
   -------     cca     ug   cu            uu             cg      a  uc  c 
5'        cucgu   caucu  ccg  ccagauugugug  ccgcuucuucuuu  ucaugc ug  cu c
          |||||   |||||  |||  ||||||||||||  |||||||||||||  |||||| ||  ||  
3'        gagua   guaga  ggc  ggucuaacgcau  ggcgaagaagaag  aguacg ac  ga a
   gagucuu     --c     --   ag            uc             au      a  ua  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr21: 5914145-5914275 [-]
intergenic
Database links

Mature sequence ppt-miR2082

Accession MIMAT0010021
Sequence

27 - 

uguguguuccgcuucuucuuu

 - 47

Get sequence
Evidence experimental; Illumina [1]

References

1